Protein Synthesis

ATGCTAAGTTAGTGCAAGCCCCAAATCTTGCATCG

Historical Influences On Darwin

1. Well Thomas Malthus focus more on people and how they evolved through poverty by natural outcomes. But him and Darwin both had the same view its just Thomas studied more on plants and how nature produce their resources.
2. Thomas Malthus was a political economist, he saw a lot of changes during the nineteen century he blame 3 types of elements such as: overproducing of the young, inability to control the amount of people and irresponsibility of lower class. He knew things had to change he wanted the families to produce less newborns that way they'll survive better rather than struggling with too many children and cant feed them and provide shelter for them this was a problems for low class families in england at the time.   http://www.ucmp.berkeley.edu/history/malthus.html
3. There are many ways of how evolution works, there are plenty of examples such as:reproducing, limited resources, gene variation and weather changing etc. The humming birds were a great observation for Darwin, because biologist of today saw the opportunity to study these species and how they evolved overtime. They realize their vill started of small and how some other ones had bigger vill proving that the longer ones were healthier and were able to easily get nectarine sometimes that wasn't always that case because climates starting changing including natural resources.
4. Charles Darwin was a smart person he was educated and like to discovered new things, he discovered the galapagos island to find answers of these wonderful species, he really studied hard to understand how they came about wanted to know more. He collected several species and looked at them one by one and felt in love with the different types of birds collected and kept them to study them for 23 years.
5. Charles Darwin success help others find interest of the species around the world, the book helped teach the people the knowledge of species and understand their natural selection and how they evolve overtime.

SCIENTIFIC METHOD

In an effort to follow the concepts prescribed on the Scientific Method scenario, I will attempt to explain a students situation where these principles can be applied.

1-      I have this theory that student’s when presented with the challenges of preparing homework or any particular study become overwhelmed with fear and anxiety that prevent them from being creative so therefore they feel really tired and affects them through the school schedule.

2-      To prove my hypothesis is quite possible that the lack of attention or interest for the subject at hand limits their ability to organize and coordinate ideas that can help them prepared for the task. Other situations that can also contribute and validate this theory is that in most cases students are preoccupied with other peripheral situations such as personal issues, work, sports or any other activities that create time constrictions resulting in a predisposed behavior.

3-      Once these realities are well-understood and accepted, perhaps the burden of having to do the work will not become such a drag and may be the outcome can be positive and possibly an effective way of dealing with this issue.