Human Variation & Race

1. 

Dealing with the heat is very difficult for us Humans because we deal with it sometime in our lifetime. The dangers of heat include many things such as: heat cramps, heat syncope or fainting, heat exhaustion and of course the major one of all heat stroke. There are countries like the Middle East and Africa that are known to be hot in areas that reach temperatures in the triple digits with a dry desert, humid weather. Nevertheless these are people that have lived in these conditions for many years and already used to adaptation, although the heat can cause serious damage to the environment and people, but there’s also the luxury of having swimming pools, air conditioning and other ways to escape the heat, but sometimes that’s not always available in some parts of the countries.

2. 

Short Term Adaptation- A short term effect of Heat can cause the body to loose fluids and salt through perspiration or replacing them in an imbalanced way which can lead to dizziness and weakness. Body temperature might rise, but possibly wont go past  102 degrees. The body feels tired and lazy in a way and you tend to feel disoriented, exhaustion kicks in and is more likely after a few days of heat wave that when one is just beginning.

Facultative Adaptation- Those who naturally live in places were the Heat hits hard have adapted to there for many years and don’t mind living in hot conditions, they find ways to deal with the heat because they probably don’t have other places to go to keep cool. So therefore the bodies are custom to the weather, with not having the feeling of getting dizzy, exhaustion or any kind of heat stroke.

Development Adaptations- People born in hot spots like the Middle East, Africa and small countries that deal with constant heat are normal. I don’t think the phenotypic causes these people to change dramatically, during developmental there is a strong belief that as the years go by these people might change, maybe only a few who feel that the Heat is too much for them and tend to cool themselves down. But the population is huge, and are adapted to this Heat already and nothing can really change them.

Cultural Adaptations- Egypt is one of the countries were Heat takes its toll just like the Middle East and Africa. But these are cultures who are already use to the Heat and to this day it remains the same. Tourist are fascinated with these countries but also find it very hot to enjoy their vacations, therefore adapting to the Heat would be difficult for them, some will get heat strokes, dehydration and possibly get sun burn, If there not protected carefully. Although the Heat is dangerous these cultures don’t mind it at all, they will still continue to move on and adapt to Heat for a long time.

3.

Human variation is very important, this was a great understanding of how people have different looks and culture that they already adapt too, not only helpful? but knowing why these climates are what they are. But the best example is the difference in skin color? to me that gave the answer away, because it gave me a better understanding to why there skin color is very tan and also avoiding the heat but covering up, could it be the Heat? thats why human variation allows us to see certain features of these people which makes sense were there from and how they got it.

4.

Many places with Heat, there are certain people who can survived the scorching Heat. different race has their own adaptation, but what if they had to live in hot desert area for example: A guy who’s a light skin living in Canada where its cold and snows would this person adapt to a place like Egypt where the sun really hits you. It might take time for this person to adjust to the Heat but in the mean time he could have difficulties surviving. There are a lot of people who do find new places to live and adapt to that weather and just have to deal with it sure it will take years but thats how the body reacts.

Language Blog

Part 1.On saturday I decided to visit my older brother and his girlfriend who I haven’t seen for a while, both were there and so I knocked on the door and he answered and I directly sat in the dining room chair. Nevertheless they were both confused by my behavior so I just kept trying to communicate with them without using any symbolic language. Not only was it difficult to communicate, but both of them were getting frustrated because they couldn’t understand what I was doing for 15 minutes. So eventually they communicated with me by simply showing hand gestures, facial expressions and also head movement and kept doing the same but it was still annoying so therefore we couldn’t get a straight answer. What if I were in two different cultures, well it would be easy to know how to write and speak because that is the best communication we have but on the other hand If I were to communicate like I did with my brother and girlfriend there’s no way to understand each other, it will take days to figure it out. In todays society we seen these views as noticeable when we see people who are deaf, blind, handicapped etc. we see this almost everyday and sometimes we do encounter people who cant communicated with us, especially people from other countries who we don’t understand their language at all even though its hard, but we still find ways to communicate such as: sign language, learning a language, drawing pictures and writing words. These are tools to help those who can’t communicate in certain ways.

Part 2.The 15 minutes on this one was just as difficult as the first one in my opinion, while still communicating with my brother and his girlfriend I showed no movement at all, I was posed like a robot without using any gestures or body movement, my goal was to do this for 15 minutes and thats what I did. Talking was normal but acted and sounded boring just like a robot. I was hoping they understand me better but when they saw me just sitting there they automatically taught I was some kind of zombie while trying really hard not to move at all. Both were trying to get the point but they seem very unamused by my talking and prompted me being lame. As I was talking about my summer trip which does have a lot of description they were unable to understand without the movement of my body. Having the trouble of not using no hand signals, non vocal intonation, no head movement or body is just frustrating especially for two people who had a hard time finding my summer story interesting. In today's society "signs" are a great visual aid to understand and record in our minds, it helps those who are not capable of understanding our body languages, because I know there are certain people who cant cope with movement and others who take these actions differently which might insult them if you don't speak and use correct body language. Although these are people who have problems understanding this language but the fact of the benefit is that its very important to learn this way so we all can communicate better, its something we deal with everyday and its crucial but to be in an environment were they don't benefit from reading body language is out of the question.

Piltdown Hoax

1. Being revealed in the early 1900’s in the small English town of Sussex, Mr. Charles Dawson got away with his findings due to the lack validation methods. In reviewing the Piltdown man hoax, it’s easy to understand why the scientific community of the time did not question the authenticity of the findings as there was any other method that could have disputed such discovery. 

2. Through persistent and inquisitive scientists in conjunction of newly developed method of evaluation by chemical absorption, 40 years later the hoax was exposed ridiculing its discovery and embarrassing the British scientific community.

3. By using others methods already available, other known scientist of the time compared the skull size and other parts found in the original pit, which started the suspicion of being of fossils of various apes due to its size and composition and leading a campaign that later exposed the biggest fraud in anthropology’s history.

4. This is a clear case of how a racially motivated and nationalist ideals of a man was able to deceive an entire community whom he represented by proposing a series of elaborate fake fossilized bones and jaws by using commonly available chemicals.

5. At the same time, thanks to skepticism by a few who doubted all along that the proposed “missing link” promoted further investigation, leads to conclude that science overall benefited from this bad experience by allowing extensive research and validation to support the earlier existence of man.

Comparative Primate

A. Trait Comparison  of Primates

Lemurs are particular trait of their social structure where large groups are common. They have adapted very well to the environment where they live, mostly found living in tree tops in the Island of Madagascar where rain forests are predominant.  

Spider Monkeys are found in various parts of the tropial forest in Central and South America where they live in groups. Highly adapted to the environment where their long limbs help them move around the trees where they spend most of the day. Mostly vegetarians. Closely related to the chimpanzees and humans for their behavior trait

Baboons are known for their powerful jaws and sharp teeth. Usually found in large groups in the African Savanna. Distinctive behavior is evident when displaying male dominance during mating seasons where the hierarchic is well-defined.  

Gibbons are very small tropical and they live all over the rainforest of southeast asia, they are know to be worlds greatest acrobats in the world, they are fast and can glide from tree to tree at a rapid speed.






Chimpanzee are found mostly in Africa, they are sorrounded by canopy forest high up in the trees. They are social animals which play around in their society and also very strong jumpy in the dry forest and savannas.


B. All 5 primates diets are:

Lemurs: Love to eat lots of plants and bugs pretty much anything small

Spider Monkeys: Love to eat seeds, fruit, insects etc.

Babbons: Love to eat grass, small antelopes, herbs, tree sap, some flowers etc.

Gibbons: Love to eat only fruit some will eat some insects.

Chimpanzee: Love to eat lots of different plants, fruit and mainly meat if they can find any.

C. Lemurs: are aggressive and fast and they leap on any tree to tree.

     Spider Monkeys: They are fast moving gliding monkeys which run away and hunt their prey fast.

     Babboon's: Are aggressive and also find lowland where there's lots of water and small rockyareas.

     Gibbons: Great acrobats they glide from tree to tree at fast speed.

     Chimpanzee: are aggressive they survive very well to the environment and hunt prey easily.

4. Its a natural selection primates live and some dont survive its whatever comes first, there are many different primates and that have special features. They can do alot of things to get the food they need and many of them can use their talents to get what they want. They will always adapt to big changes in the environments but they will continue to survive if their traits stay the same.

Analogy/Homology

1. For your homologus traits provide the following information 

a. A Cat and a Tiger they're both vertebrates

b. They are both 4-legged species, hunters one being very large and strong and the other very quiet, small and agile with very different characteristics in behavior as the cat can be domesticated and other lives in a wild environment

c. Their common ancestry relates to mammals with 4 legs that evolved to become what they are today.

d
     








2. For your analogous traits provide the following information 

a. A Bird and a Butterfly posses wings

b. Although they're both different species they share a particular trait as both posses wings and can fly.

c  It is quite likely that both their ancestry had the wings as main common trait

d.     

Protein Synthesis

ATGCTAAGTTAGTGCAAGCCCCAAATCTTGCATCG

Historical Influences On Darwin

1. Well Thomas Malthus focus more on people and how they evolved through poverty by natural outcomes. But him and Darwin both had the same view its just Thomas studied more on plants and how nature produce their resources.
2. Thomas Malthus was a political economist, he saw a lot of changes during the nineteen century he blame 3 types of elements such as: overproducing of the young, inability to control the amount of people and irresponsibility of lower class. He knew things had to change he wanted the families to produce less newborns that way they'll survive better rather than struggling with too many children and cant feed them and provide shelter for them this was a problems for low class families in england at the time.   http://www.ucmp.berkeley.edu/history/malthus.html
3. There are many ways of how evolution works, there are plenty of examples such as:reproducing, limited resources, gene variation and weather changing etc. The humming birds were a great observation for Darwin, because biologist of today saw the opportunity to study these species and how they evolved overtime. They realize their vill started of small and how some other ones had bigger vill proving that the longer ones were healthier and were able to easily get nectarine sometimes that wasn't always that case because climates starting changing including natural resources.
4. Charles Darwin was a smart person he was educated and like to discovered new things, he discovered the galapagos island to find answers of these wonderful species, he really studied hard to understand how they came about wanted to know more. He collected several species and looked at them one by one and felt in love with the different types of birds collected and kept them to study them for 23 years.
5. Charles Darwin success help others find interest of the species around the world, the book helped teach the people the knowledge of species and understand their natural selection and how they evolve overtime.

SCIENTIFIC METHOD

In an effort to follow the concepts prescribed on the Scientific Method scenario, I will attempt to explain a students situation where these principles can be applied.

1-      I have this theory that student’s when presented with the challenges of preparing homework or any particular study become overwhelmed with fear and anxiety that prevent them from being creative so therefore they feel really tired and affects them through the school schedule.

2-      To prove my hypothesis is quite possible that the lack of attention or interest for the subject at hand limits their ability to organize and coordinate ideas that can help them prepared for the task. Other situations that can also contribute and validate this theory is that in most cases students are preoccupied with other peripheral situations such as personal issues, work, sports or any other activities that create time constrictions resulting in a predisposed behavior.

3-      Once these realities are well-understood and accepted, perhaps the burden of having to do the work will not become such a drag and may be the outcome can be positive and possibly an effective way of dealing with this issue.